Information

Pseudosexual reproduction

Pseudosexual reproduction


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Research projects with artificial life generally use creatures that are haploid. The offspring randomly inherit some genes from one parent, and some genes from the other parent.

Q1: Are there any biological species which reproduce similarly? I.e., they're haploid, but the offspring aren't clones. Perhaps hermaphroditic species like slugs or some plants?

Q2: Is there a name for this type of reproduction? If not, I guess I'll call it "pseudosexual" since it's a simplified form of true sexual reproduction.


Generally, all diploid species pass through a haploid phase in their life. This is called the alternation of generations and the cycle may be presented like this:

Commonly we see organisms that spend most of their life in the diploid phase, with greatly reduced haploid phase (e.g. humans "live" in haploid state only as gametes). However, this is not the only way possible. There are organisms, which spend similar amount of time in each phase, which change ploidy depending on the conditions of the environment and, of course, organisms which spend most of their lives as haploids, with only a short diploid stage.

As a rule, lower plants, fungi and protozoa may exibit this behaviour. Some examples:

  • Saccharomyces cerevisiae (yes, baker's yeast) will undergo meiosis and form haploid spores in unfavourable conditions, which then can grow as haploid colonies until they encounter a colony of opposite "sex"
  • Mosses commonly grow larger gametophytes (haploid) than sporophytes (diploid)
  • Some brown algae grow sporophytes and gametophytes that are indistinguishable form each other
  • Ferns often grow large sporophytes and small, but self-sufficient gametophytes.

Next question should be "why only lower plants and fungi?" And the shortest answer is that a diploid organism is usually more robust, it can survive more potentially lethal mutations than a haploid.


  1. I don't know any example of haploid, but (pseudo)sexually reproducing artificial life (and hardly any at all existed 4 years ago when the question was posted!). So I assume you meant in-silico life. Then, yes, usually as you described.
  2. There is no regular mechanism of inheriting some genes from one parent, some from the other, when parents are haploid. Such mechanism in diploid parent is meiosis, which is not, of course, possible in haploids.
  3. Rather irregular processes that involves 2 haploid nuclei (identical or not) similar to what you describe are known in some basal eukaryotes (excavates) and in fungi lacking regular sexual cycle. In different contexts these cycles are called pseudo-, as you suggested, or para-sexual cycles.

Cnemidophorus

2.3.1.4 Teiidae

Whiptail lizards of the genus Cnemidophorus have been studied extensively and have yielded tremendous insights into hormone–reproduction relationships. This genus has multiple parthenogenetic species, but the best studied by far is the desert-grassland whiptail, Cnemidophorus uniparens, a triploid, all-female species that arose from the hybridization of the little striped whiptail, C. inornatus, and, most likely, the rusty-rumped whiptail, Cnemidophorus burti (reviewed in Godwin & Crews, 2002 Crews & Moore, 2005 Dias & Crews, 2008 ). All species in this genus are oviparous, regardless of whether reproduction is sexual or parthenogenetic.

In the sexually reproducing C. inornatus, males have high plasma T and especially high DHT concentrations when reproductively active and detectable but not significantly different plasma P4 concentrations across the breeding season plasma E2 is not detected ( Moore & Crews, 1986 ). Castration diminishes male courtship and copulatory behavior, and implants of T, DHT, and P4 (alone or synergistically with T) restore these behaviors in previously castrated males ( Lindzey & Crews, 1986 Sakata, Woolley, Gupta, & Crews, 2003 ). In females, plasma E2 is highest before ovulation, and plasma P4 is highest after ovulation and before oviposition plasma androgens are not detectable ( Moore & Crews, 1986 ). In both males and females, the presence of the opposite sex is important for stimulating gonadal recrudescence ( Lindzey & Crews, 1988 ). In the parthenogenetic C. uniparens, there is no opposite sex to stimulate behavior rather, individuals alternate in expressing male-typical mounting behavior and female-typical receptive behavior of the ancestor sexual species. As for C. inornatus, plasma E2 concentration is higher prior to ovulation and plasma P4 concentration is higher following ovulation in C. uniparens (Moore, Whittier, & Crews, 1985). Thus, this endocrine profile is conserved, but the response to it has changed. Prior to ovulation (high E2, low P4), individuals are more likely to express female-typical receptive behavior during pseudosexual interactions following ovulation and until oviposition (low E2, high P4), individuals are more likely to express male-typical mounting behavior during pseudosexual interactions (Moore, Whittier, Billy, & Crews 1985). As seen for C. inornatus, experimentally elevated plasma T or P4 (alone or in synergism with T) promotes male-typical mounting behavior in C. uniparens as well ( Sakata et al., 2003 ). This sensitivity to T exists in spite of the fact that plasma T is undetectable throughout the breeding season in C. uniparens ( Crews, Grassman, & Lindzey, 1986 ). Further, although male and female C. inornatus express sex differences in brain regions associated with reproduction and typical of other vertebrates (males have a larger anterior hypothalamus-preoptic area (AH-POA) and females have a larger ventromedial region of the hypothalamus (VMH)), in the all-female C. uniparens, both brain regions are comparable in size to those of female C. inornatus, regardless of reproductive state ( Wade & Crews, 1991 ). Thus, like endocrine profiles, size relationships in brain regions associated with reproduction are conserved. Recent work by Dias and Crews (2008) suggests that the brain neurotransmitter serotonin links hormones and behavior in C. uniparens, as in many other taxa, by playing an inhibitory role in the expression of reproductive behavior. Serotonin presence in the AH-POA suppresses mounting, whereas in the VMH it suppresses receptivity.


Behavioral facilitation of reproduction in sexual and unisexual whiptail lizards

All-female, parthenogenetic species afford a unique test of hypotheses regarding the nature and evolution of sexuality. Mating behavior accomplishes the transfer of gametes and stimulates the coordination of reproductive activity of the male and female. Cnemidophorus uniparens, a parthenogenetic species, is believed to have resulted from the hybridization of two extant gonochoristic species, Cnemidophorus inornatus and Cnemidophorus gularis. C. uniparens regularly and reliably perform behaviors identical in form to those performed during mating by male C. inornatus. We have determined experimentally that individuals of the parthenogenetic species demonstrating male-like pseudosexual behavior also share a similarity in function with males of the sexually reproducing species. The number of female C. inornatus ovulating increases, and the latency to ovulation decreases, if a sexually active conspecific male is present. A similar facilitatory effect on ovarian recrudescence occurs in the all-female C. uniparens in the presence of a male-like individual. These results show that behavioral facilitation of ovarian recrudescence is important in sexual and unisexual species. This may represent a potent selection pressure favoring the maintenance of male-typical behaviors, thus accounting for the display of behavioral traits usually associated with males in unisexual species of hybrid origin.


Materials and Methods

Selection experiment

We established eight independent replicate populations for each of three treatments: a sexual treatment which enforced frequent outcrossed sex and two asexual control treatments. The first control group was designated the budding treatment and used the same strain as the sexual treatment but allowed to grow mitotically. As the process of inducing sporulation in the sexual treatment involves prolonged starvation of the cells, we included a second asexual control designated the pseudosexual treatment, in which an obligate asexual strain underwent the same experimental regime as the sexual treatment but remained diploid throughout.

The sexual and budding treatments were founded from a heterozygous diploid strain ho/ho a/α URA3/ura3∆ lys2∆/LYS2, derived by a cross between haploid strains DH89 MATα ho lys2∆ and DH89 MATa ho ura3∆ (Goddard et al., 2001 ). The pseudosexual treatment was founded from an obligately asexual strain described by Goddard et al. ( 2005 ).

Each population was initiated from individual colonies of either the sexual (sexual and budding treatments) or asexual (pseudosexual treatment) strain. Populations were grown in shaken 30 mL microcosms in 10 mL minimal media (MM: 0.17% yeast nitrogen base without amino acids or ammonium sulphate, 0.5% ammonium sulphate, 2% glucose) using amino acid supplementation as described below for 30 h at 30 °C. Following mitotic growth, sexual and pseudosexual populations were washed and resuspended in 0.5% potassium acetate solution and allowed to sporulate at 30 °C for 6 days. These cultures were then digested in 3 mL ascus-digestion solution (80 U mL −1 lyticase, 50 m m dithiothreitol, 1100 U mL −1 β-glucuronidase) at 37 °C for 3 h to digest bonds between spores within the ascus and the cell walls of unsporulated diploids. Spore clusters were disrupted and randomized by sonication and resuspended into 1 mL YPD (2% glucose, 1% yeast extract and 1% peptone) to allow sexual populations to mate at 30 °C for 3 h. In the pseudosexual treatment, spores remain diploid throughout and therefore germinate but do not mate. Half of this culture was then used to inoculate fresh media for the next transfer, whereas the other half was frozen in 30% glycerol at −80 °C for further analysis. During the sporulation process, budding populations were placed in 0.09% NaCl at 10 °C and 50 μL used to inoculate fresh MM at the same time as the asexual and sexual populations. For all treatments, population size during transfer bottlenecks was maintained at > 10 6 cells.

The heterozygosity of the sexual strain at the URA3 and LYS2 loci was used to ensure that sex was maintained throughout the experiment in the sexual treatment. During odd transfers, we grew sexual populations in media without amino acids, selecting for the URA3+/LYS+ phenotype. During even transfers, we split each culture in two growth populations, growing one in MM + uracil + 5FOA, selecting for ura- LYS+ phenotypes, and one in MM + lysine + αAA, selecting for URA+ lys- phenotypes. Split cultures were then pooled prior to sporulation and mating. Consequentially, genotypes selected for in one transfer are unable to grow in the next (Table S1), therefore selecting for outcrossed diploids only. To control for possible effects of the fluctuating environment, we also alternated the media between MM for odd transfers and MM + uracil for even in the pseudosexual treatment. Budding populations were always grown in MM without supplementation.

Growth rate and plasmid copy number measurements

Cultures from transfers 0 and 20 were plated on to MM (+amino acids), and 15 colonies were picked at random for analysis and inoculated into 200 μL MM media in 96-well plates. These were grown overnight, and 10 μL was used to inoculate fresh 96-well plates including positive (ancestral strains) and negative (no yeast) controls. Growing cultures were read every 2 h using a Biotek Synergy HT plate reader at OD600 nm for 60 h and incubated at 30 °C between reads. Maximum growth rate (mOD per min) was measured as the maximum slope in OD600 measured across five 2 h time points. In a number of cases, clones failed to grow (defined as maximum OD < 0.1). These cultures were excluded from future analyses. Following growth to saturation, DNA was extracted using the Promega Wizard ® SV 96 Genomic DNA Purification System (Promega, Madison, WI, USA).

Plasmid copy number was measured using quantitative PCR. DNA extractions were diluted 10-fold and amplified with primers targeting the FLP gene of the 2-μm plasmid (for TTCAATGAAGGGCCTAACGG, rev TCGCTCCAATTTCCCACAAC) and the HO gene as a yeast genomic control (for CGGTTTGTGACGATCACGTT, rev CCTGTTTTCATCTGGACCATCTC). To check the efficacy of these primers and to ensure that sequence mutation or genome rearrangements in the evolved populations have not influenced the binding of these primers, we compared copy number estimates for sexual populations using alternative plasmid targets the inverted repeat regions (for = AGGTGCGACGTGAACAGTGA, rev = GAAAATGCAACGCGAGCTG) and the STB region (for = CATCCCCGGTTCATTTTCTG, rev = AGATATGCTATTGAAGTGCAAGATGG). No difference was observed between these primer sets. QPCR was conducted on an ABI Prism 7000 PCR machine using SensiMix Real-Time PCR mix (Bioline, London, UK). PCR conditions were as follows: 1 cycle at 95 °C for 10 min and 40 cycles consisting of 95 °C for 15 s, 60 °C for 1 min and 72 °C for 1 min. Actual copy number of strain Y55 was estimated from the standard curve by comparing the intercept of the FLP target to that of the HO single copy genomic reference (Livak & Schmittgen, 2001 ). The standard curves were also used to determine reaction efficiency following Lee et al. ( 2006 ) and any plates in which the standard curves indicated < 95% reaction efficiency were redone. Relative copy number for each sample was estimated by the ΔΔCT method (Lee et al., 2006 ), and the estimated copy number of each sample was calculated as relative copy number sample × actual copy number Y55 . Each sample was amplified twice, and the mean of these estimates used for analyses.

Screening for AR-deficient mutants

Populations were screened at transfers 0, 5, 10, 15, 20 and 22. Cultures were plated onto YPD agar, containing a fermentable glucose carbon source and grown at 30 °C for 2 days. These were then replica plated onto YPG (2% glycerol, 1% yeast extract and 1% peptone), containing glycerol which is nonfermentable. Clones that have lost the ability to respire are therefore unable to grow on YPG. These were grown at 30 °C for 2 days and > 200 colonies per population scored for AR function.

Statistical analysis

All analyses were conducted in r statistical package (R Foundation for Statistical Computing). Copy number and growth rate estimates were Ln transformed to normalize residuals. Mitochondrial mutant data, as it was proportional, were arcsine-square-root-transformed prior to analysis. Direct comparisons were made using Welch's t-tests, which allow for unequal variances, and factorial analyses were conducted using anova .

Given these two relations, the likelihood L(d,q0|m,n,t) of observing m mutants in a sample of n cells after t generations with be a function of the rate of drive, d, and the initial frequency of the mutant mitochondria, q0. We estimated q0 as the average frequency of mutant mitochondria in the eight replicate sexual populations at the beginning of the experiment (0.00266), and for each population found by numerical iteration the value of d that maximized the probability of obtaining the data across the six measurements (at transfers 0, 5, 10, 15, 20 and 22). This calculation does not include the harmful effects of AR mitochondria on host fitness and so will tend to underestimate the true rate of transmission.


Results

Genome-Wide LOH Rate

We screened 141 microsatellite markers in 20 MA lines of D. pulex (PX) and 95 microsatellite markers in 28 lines of D. obtusa (OB). One hundred and eight microsatellites in D. pulex and 34 microsatellites in D. obtusa were heterozygous in the founder of the MA lines and were therefore informative for detecting LOH events ( table 1). In total, 24 LOH events were detected for 15 microsatellite markers in 20 PX MA lines over an average of 116 generations, whereas 41 LOH events for 15 microsatellite markers occurred in 28 OB MA lines over an average of 190 generations ( table 1 and supplementary table S1 , Supplementary Material online). The rate of LOH events was 9.58 × 10 −5 (PX) and 2.27 × 10 −4 (OB) events locus −1 generation −1 , respectively ( table 1). Given that LOH rates from microsatellite loci and protein-coding loci ( Omilian et al. 2006) are consistent (1.7 × 10 −4 locus −1 generation −1 ), we suggest that the microsatellite-based LOH rates are representative of the entire genome.

The number of LOH events for each individual MA line ranged from zero to nine. A maximum of three nonconsecutive LOH events on the same chromosome occurred in the PX MA lines ( fig. 1). The lack of a genetic linkage map for D. obtusa prevented us from determining the genomic location of LOH events in the OB MA lines. Hotspots for LOH events, defined as loci that displayed LOH in three or more individual MA lines, were also identified: d050 (7 lines) and d083 (3 lines) for PX and d024 (6 lines), d027 (3 lines), and d068 (17 lines) for OB.

Map locations for LOH loci (open circles) and hemizygous LOH loci (black circles) in the D. pulex MA lines. Only 7 of 12 screened chromosomes contain markers that underwent LOH. The ancestral diploid state for each chromosome is shown on the left of the map, with heterozygous loci in black type and homozygous loci in gray type. Numbers on the left indicate map distances (centimorgans), and numbers to the right indicate marker names. LOH profiles are shown to the right of the linkage map for each chromosome, with the MA line showing that profile indicated below.

Map locations for LOH loci (open circles) and hemizygous LOH loci (black circles) in the D. pulex MA lines. Only 7 of 12 screened chromosomes contain markers that underwent LOH. The ancestral diploid state for each chromosome is shown on the left of the map, with heterozygous loci in black type and homozygous loci in gray type. Numbers on the left indicate map distances (centimorgans), and numbers to the right indicate marker names. LOH profiles are shown to the right of the linkage map for each chromosome, with the MA line showing that profile indicated below.

Rate of Hemizygous Deletions in D. pulex

Following the TI for QuMA analysis, LOH loci with DNA copy numbers less than 1.20 should be regarded as hemizygous. In total, 16 of 24 LOH events appeared to be hemizygous. Seven microsatellite loci experienced hemizygosity, and the loci d050 and d083 were found to be hemizygous in multiple MA lines ( fig. 1). The rate of hemizygous deletions in the D. pulex MA lines is 6.7 × 10 −5 locus −1 generation −1 ( table 1). Based on the Daphnia genome annotation (wfleabase.org), all hemizygous loci span open reading frames ( supplementary table S4 , Supplementary Material online), and thus, the deletions are likely deleterious. We also investigated an unusually long LOH tract spanning a string of 14 microsatellite loci. Of these, two internal loci (d054 and d078) were found to be hemizygous, whereas the rest maintained a copy number of two ( fig. 1 and supplementary table S3 , Supplementary Material online). This finding indicates that the long LOH tract is likely due to a crossover event followed by internal hemizygous deletions.

Physical Lengths of Hemizygous Deletions in D. pulex

qPCR experiments on linked markers in the regions located near focal hemizygous loci revealed that the physical lengths of deletion tracts for markers d050, d083, d054, and d078 ranged from ∼2 to 30 kb ( fig. 2 and table 2). Deletion tracts of dramatically different lengths were detected among individual MA lines at locus d050. For example, ∼2 kb deletions were observed in the PX35 and PX43 lines, whereas PX2, PX5, and PX32 experienced deletion tracts of 25–30 kb. Deletions for locus d083 were similar in length (∼23 kb) for both MA individuals, PX41 and PX43. Although markers d054 and d078 are adjacent in PX6, their deletion tracts were separated by an internal diploid segment the physical lengths for d054 and d078 were ∼9 and ∼13 kb, respectively. All deletions span open reading frames ( supplementary fig. S1 , Supplementary Material online).

Summary of the Hemizygous Deletion Tracts in the D. pulex MA Lines, with Genomic Coordinates (wfleabase.org) and Lengths (base pairs) of the Affected Genomic Regions.

Locus MA Line Genomic Location Length (bp)
d054 PX6 scaffold_62:48915-61803 12,889
d078 PX6 scaffold_62:121813-130992 9,180
d050 PX2 scaffold_63:448169-472883 24,715
d050 PX5, PX32 scaffold_63:448169-477951 29,782
d050 PX35, PX43 scaffold_63:448169-450291 2,123
d083 PX41, PX43 scaffold_17:891889-914491 22,603
Locus MA Line Genomic Location Length (bp)
d054 PX6 scaffold_62:48915-61803 12,889
d078 PX6 scaffold_62:121813-130992 9,180
d050 PX2 scaffold_63:448169-472883 24,715
d050 PX5, PX32 scaffold_63:448169-477951 29,782
d050 PX35, PX43 scaffold_63:448169-450291 2,123
d083 PX41, PX43 scaffold_17:891889-914491 22,603

N OTE. —MA, mutation accumulation.

Summary of the Hemizygous Deletion Tracts in the D. pulex MA Lines, with Genomic Coordinates (wfleabase.org) and Lengths (base pairs) of the Affected Genomic Regions.

Locus MA Line Genomic Location Length (bp)
d054 PX6 scaffold_62:48915-61803 12,889
d078 PX6 scaffold_62:121813-130992 9,180
d050 PX2 scaffold_63:448169-472883 24,715
d050 PX5, PX32 scaffold_63:448169-477951 29,782
d050 PX35, PX43 scaffold_63:448169-450291 2,123
d083 PX41, PX43 scaffold_17:891889-914491 22,603
Locus MA Line Genomic Location Length (bp)
d054 PX6 scaffold_62:48915-61803 12,889
d078 PX6 scaffold_62:121813-130992 9,180
d050 PX2 scaffold_63:448169-472883 24,715
d050 PX5, PX32 scaffold_63:448169-477951 29,782
d050 PX35, PX43 scaffold_63:448169-450291 2,123
d083 PX41, PX43 scaffold_17:891889-914491 22,603

N OTE. —MA, mutation accumulation.

Physical map of the hemizygous deletion tracts encompassing the loci d054, d078, d050, and d083 that experienced LOH in multiple MA lines. Letters denote the markers used in qPCR experiments ( Supplementary table S2 , Supplementary Material online). Black boxes represent hemizygous markers, whereas open boxes denote diploid markers. Gray areas indicate the inferred deletion tracts. Numbers above boxes indicate the DNA copy number for each marker tested. The marker d195 is a heterozygous marker (i.e., DNA copy number is 2) according to the genotyping results, although no qPCR experiments have been performed using this locus.

Physical map of the hemizygous deletion tracts encompassing the loci d054, d078, d050, and d083 that experienced LOH in multiple MA lines. Letters denote the markers used in qPCR experiments ( Supplementary table S2 , Supplementary Material online). Black boxes represent hemizygous markers, whereas open boxes denote diploid markers. Gray areas indicate the inferred deletion tracts. Numbers above boxes indicate the DNA copy number for each marker tested. The marker d195 is a heterozygous marker (i.e., DNA copy number is 2) according to the genotyping results, although no qPCR experiments have been performed using this locus.


Results

Neurochemical levels in naturally cycling and hormonally manipulated C. uniparens

PostOv animals had significantly lower 5-HT levels than PreOv animals in the POA (5-HT: F1,8 = 7.538 P < 0.05) ( Fig. 1, top panel). No significant differences in 5-HT levels were observed in the VMN across ovarian states. DA levels were not significantly different between PreOv and PostOv animals in any of the regions examined (DA: P > 0.05).

5-HT levels vary in the POA of the unisexual lizard (C. uniparens) during the natural cycle (top panel), as well as after hormonal manipulation (bottom panel). Naturally cycling PostOv lizards (n = 5) have lower levels of 5-HT relative to PreOv animals (n = 4) in the POA a similar pattern is observed in OVX and androgen-implanted lizards (OVX plus T n = 5) relative to OVX and estradiol-injected animals (OVX plus E n = 4). OVX lizards (n = 5) have higher 5-HT levels in the POA compared with OVX plus T and OVX plus E animals. No significant differences were detected in the VMN of naturally cycling animals. OVX lizards (n = 5) had significantly higher 5-HT levels than OVX plus T animals in the VMN. Data are expressed as mean ± sem . *, P < 0.05 **, P < 0.01 ***, P < 0.001.

5-HT levels vary in the POA of the unisexual lizard (C. uniparens) during the natural cycle (top panel), as well as after hormonal manipulation (bottom panel). Naturally cycling PostOv lizards (n = 5) have lower levels of 5-HT relative to PreOv animals (n = 4) in the POA a similar pattern is observed in OVX and androgen-implanted lizards (OVX plus T n = 5) relative to OVX and estradiol-injected animals (OVX plus E n = 4). OVX lizards (n = 5) have higher 5-HT levels in the POA compared with OVX plus T and OVX plus E animals. No significant differences were detected in the VMN of naturally cycling animals. OVX lizards (n = 5) had significantly higher 5-HT levels than OVX plus T animals in the VMN. Data are expressed as mean ± sem . *, P < 0.05 **, P < 0.01 ***, P < 0.001.

There was a significant effect of hormonal manipulation on 5-HT but not on DA levels in the POA (5-HT: F2,11 = 40.089, P < 0.001 DA: F2,11 = 2.554, P > 0.05). In the POA, OVX plus T animals had significantly lower 5-HT levels than both OVX plus E animals (P < 0.05) and OVX animals (P < 0.001), whereas OVX plus E animals had significantly lower 5-HT levels than OVX controls (P < 0.01) ( Fig. 1, bottom panel). In the VMN, hormonal manipulation significantly affected 5-HT but not DA levels (5-HT: F2,11 = 4.440, P < 0.05 DA: F2,11 = 0.616, P > 0.05). OVX plus T animals had significantly lower 5-HT levels than OVX animals (P < 0.05).

5-HT receptor subtype mRNA expression in brain nuclei of naturally cycling and hormonally manipulated C. uniparens

PreOv animals have less 5-HT1A mRNA in the POA compared with PostOv lizards (F1,14 = 5.370, P < 0.05) ( supplemental Fig. 1 , B and C , and Fig. 2). Similar levels were measured in the CxD and VMN across the ovarian cycle. 5-HT2A mRNA levels in the VMN were significantly lower in the PreOv group compared with PostOv animals (F1,14 = 5.372 P < 0.05) ( Fig. 2). Levels in the POA and CxD were unchanged across both groups.

5-HT receptor subtype mRNA expression in the POA, VMN, and dorsolateral cortex (CxD) vary in the unisexual lizard (C. uniparens) during the natural cycle (left panel), as well as after hormonal manipulation (right panel) as measured by radioactive in situ hybridization using riboprobes specific to lizard 5-HT1A and 5-HT2A receptors. PostOv lizards have significantly more 5-HT1A mRNA in the POA than PreOv animals OVX and androgen-implanted (OVX plus T) showed the same trend compared with OVX and estradiol-injected lizards (OVX plus E). There are no significant differences in 5-HT1A mRNA levels in the CxD and VMN. PostOv and OVX plus T-implanted animals have more 5-HT2A mRNA in the POA compared with PreOv and OVX plus E-injected lizards, respectively, whereas 5-HT2A mRNA levels in the VMN were significantly higher in the OVX plus T-implanted group compared with OVX plus E-injected animals. No significant differences in 5-HT2A mRNA levels were detected in the CxD. Data are expressed as mean ± sem (n = 7 per group). *, P < 0.05.

5-HT receptor subtype mRNA expression in the POA, VMN, and dorsolateral cortex (CxD) vary in the unisexual lizard (C. uniparens) during the natural cycle (left panel), as well as after hormonal manipulation (right panel) as measured by radioactive in situ hybridization using riboprobes specific to lizard 5-HT1A and 5-HT2A receptors. PostOv lizards have significantly more 5-HT1A mRNA in the POA than PreOv animals OVX and androgen-implanted (OVX plus T) showed the same trend compared with OVX and estradiol-injected lizards (OVX plus E). There are no significant differences in 5-HT1A mRNA levels in the CxD and VMN. PostOv and OVX plus T-implanted animals have more 5-HT2A mRNA in the POA compared with PreOv and OVX plus E-injected lizards, respectively, whereas 5-HT2A mRNA levels in the VMN were significantly higher in the OVX plus T-implanted group compared with OVX plus E-injected animals. No significant differences in 5-HT2A mRNA levels were detected in the CxD. Data are expressed as mean ± sem (n = 7 per group). *, P < 0.05.

5-HT1A mRNA in the POA of OVX plus T-implanted lizards tended to be greater than that found in OVX plus E-injected animals (F1,11 = 4.594 P = 0.06) ( Fig. 2). Similar levels were measured in the CxD and VMN across both hormonal groups. 5-HT2A mRNA levels in the POA were greater in OVX plus T-implanted lizards compared with OVX plus E-injected animals (F1,11 = 4.760 P = 0.05) ( Fig. 2). In the VMN, 5-HT2A mRNA levels were significantly lower in the OVX plus E-injected group compared with OVX plus T-implanted animals (F1,11 = 5.815 P < 0.05). Levels in the CxD were unchanged across both groups.

Effect of intracranial injection of 5-HT in the POA and VMN

There was a significant interaction between treatment (saline or 5-HT) and placement (within or outside the POA) on the latency to mount a stimulus receptive animal by OVX plus T-implanted lizards (F1,24 = 9.967 P < 0.01) ( Fig. 3B). Tukey post hoc analysis indicated that animals injected with 5-HT into the POA took significantly longer to mount the stimulus animals compared with all other groups (P < 0.01). No other significant differences between groups were noted. None of the test animals expressed female-like receptivity. Furthermore, ip injection of methysergide (a broad 5-HT receptor antagonist) 1 h before intracranial injection of 5-HT prevented the suppression of male-like pseudocopulation as observed previously (latency to mount: 545 ± 27, mean seconds ± sem ) in four of four OVX plus T animals (latency to mount: 91 ± 31).

A, Intracranial injection of 5-HT into the POA inhibits mounting behavior of OVX androgen-implanted unisexual C. uniparens lizards. Lizards that were robustly and reliably mounting receptive stimulus animals during baseline tests (n = 29) were injected with either saline or 5-HT (in POA-saline, n = 7 and 5-HT, n = 9 outside POA-saline, n = 7 and 5-HT, n = 6). Top panels are representative photomicrographs of the site of injection (arrow) into the POA (left) but not into the VMN of the same animal (right). B, Only when 5-HT was injected into the POA was the latency to mount the stimulus receptive significantly increased. Data are expressed as mean ± sem . **, P < 0.01. LFB, Lateral forebrain bundle OT, optic tract III, third ventricle.

A, Intracranial injection of 5-HT into the POA inhibits mounting behavior of OVX androgen-implanted unisexual C. uniparens lizards. Lizards that were robustly and reliably mounting receptive stimulus animals during baseline tests (n = 29) were injected with either saline or 5-HT (in POA-saline, n = 7 and 5-HT, n = 9 outside POA-saline, n = 7 and 5-HT, n = 6). Top panels are representative photomicrographs of the site of injection (arrow) into the POA (left) but not into the VMN of the same animal (right). B, Only when 5-HT was injected into the POA was the latency to mount the stimulus receptive significantly increased. Data are expressed as mean ± sem . **, P < 0.01. LFB, Lateral forebrain bundle OT, optic tract III, third ventricle.

Intracranial injection (saline or 5-HT) was a significant predictor of receptivity in OVX plus E animals after the injection with receptivity being suppressed in a greater percentage of 5-HT injected animals compared with saline-injected controls (X 2 = 11.255 P < 0.01 binary logistic regression with treatment, placement, and treatment × placement interaction as predictors of receptivity) ( Fig. 4, bottom graph). Examination of the data indicates that receptivity is suppressed by 5-HT injection into the VMN, and not outside this brain nucleus. Male-like pseudocopulation was not exhibited by any of the animals.

Intracranial injection of 5-HT into the VMN inhibits receptive behavior of OVX estradiol-injected unisexual C. uniparens lizards. Lizards that were robustly and reliably receptive to the mounting behavior of stimulus animals during baseline tests (n = 29) were injected with either saline or 5-HT (in VMN-saline, n = 7 and 5-HT, n = 9 outside VMN-saline, n = 7 and 5-HT, n = 6). Top panels are representative photomicrographs of the site of injection into the VMN (arrow) (right) but not into the POA of the same animal (left). Bottom graph indicates that only when 5-HT was injected into the VMN was the percentage of animals showing receptivity decreased (**, P < 0.01). Data represented as the percentage of animals showing a receptive phenotype. III, Third ventricle.

Intracranial injection of 5-HT into the VMN inhibits receptive behavior of OVX estradiol-injected unisexual C. uniparens lizards. Lizards that were robustly and reliably receptive to the mounting behavior of stimulus animals during baseline tests (n = 29) were injected with either saline or 5-HT (in VMN-saline, n = 7 and 5-HT, n = 9 outside VMN-saline, n = 7 and 5-HT, n = 6). Top panels are representative photomicrographs of the site of injection into the VMN (arrow) (right) but not into the POA of the same animal (left). Bottom graph indicates that only when 5-HT was injected into the VMN was the percentage of animals showing receptivity decreased (**, P < 0.01). Data represented as the percentage of animals showing a receptive phenotype. III, Third ventricle.

Effect of a 5-HT1A receptor agonist (8-OH-DPAT) on pseudosexual behavior

Intraperitoneal administration of 8-OH-DPAT to OVX plus T lizards significantly increased the latency to mount stimulus receptive females (F2,32 = 649.68 P < 0.001) ( Table 1). Tukey post hoc analysis indicated that OVX plus T animals injected with DPAT took significantly longer to mount the stimulus animals 20 min after drug administration compared with all other groups (P < 0.001). No other significant differences between groups were noted. 8-OH-DPAT did not affect the receptivity exhibited by OVX plus E lizards (data not shown).

Stimulation of 5-HT2A receptors by DOI stimulates receptive behavior, in OVX, androgen-treated (OVX plus T) C. uniparens: 8-OH-DPAT, dependent variable, latency to mount (sec)

Saline . DPAT .
Before drug . 20 min after drug . 45 min after drug . Before drug . 20 min after drug . 45 min after drug .
10.11 ± 1.78 10.89 ± 1.81 9.22 ± 1.27 8.11 ± 1.35 578.33 ± 21.6 a 14.11 ± 3.38
Saline . DPAT .
Before drug . 20 min after drug . 45 min after drug . Before drug . 20 min after drug . 45 min after drug .
10.11 ± 1.78 10.89 ± 1.81 9.22 ± 1.27 8.11 ± 1.35 578.33 ± 21.6 a 14.11 ± 3.38

Hormonally manipulated lizards (OVX plus T) were injected ip either with 0.9% saline or 1 mg/kg 8-OH-DPAT (n = 9 per group), and their latency to mount was noted before (before drug), 20 min after injection (20 min after drug), or 45 min after injection (45 min after drug). Data are represented as mean ± sem . Lizards took significantly longer to mount a receptive stimulus animal 20 min after 8-OH-DPAT injection and returned to baseline mount latencies 45 min after injection.

Stimulation of 5-HT2A receptors by DOI stimulates receptive behavior, in OVX, androgen-treated (OVX plus T) C. uniparens: 8-OH-DPAT, dependent variable, latency to mount (sec)

Saline . DPAT .
Before drug . 20 min after drug . 45 min after drug . Before drug . 20 min after drug . 45 min after drug .
10.11 ± 1.78 10.89 ± 1.81 9.22 ± 1.27 8.11 ± 1.35 578.33 ± 21.6 a 14.11 ± 3.38
Saline . DPAT .
Before drug . 20 min after drug . 45 min after drug . Before drug . 20 min after drug . 45 min after drug .
10.11 ± 1.78 10.89 ± 1.81 9.22 ± 1.27 8.11 ± 1.35 578.33 ± 21.6 a 14.11 ± 3.38

Hormonally manipulated lizards (OVX plus T) were injected ip either with 0.9% saline or 1 mg/kg 8-OH-DPAT (n = 9 per group), and their latency to mount was noted before (before drug), 20 min after injection (20 min after drug), or 45 min after injection (45 min after drug). Data are represented as mean ± sem . Lizards took significantly longer to mount a receptive stimulus animal 20 min after 8-OH-DPAT injection and returned to baseline mount latencies 45 min after injection.

Effect of a 5-HT2A/2C receptor agonist (DOI) on pseudosexual behavior

The administration of DOI elicited a receptive phenotype in OVX plus T animals 20 min after drug administration, with animals returning to a nonreceptive state 50 min after injection (X 2 = 12.713 P < 0.001) ( Table 2). Pretreatment with dimethylsulfoxide and DOI 10 min later elicited receptivity in 75% of OVX plus T animals 20 min after drug administration, whereas pretreatment with ketanserin (3 mg/kg, ip) followed by DOI resulted in none of the OVX plus T animals being receptive. DOI administration had no effect on male-like pseudocopulation in OVX plus T-implanted animals. The receptivity already observed in OVX plus E-injected animals was unaffected by DOI administration (data not shown).

Stimulation of 5-HT2A receptors by DOI stimulates receptive behavior, in OVX, androgen-treated (OVX plus T) C. uniparens: DOI, dependent variable, percentage (%) of receptive animals

Saline . DOI .
Before drug . 20 min after drug . 50 min after drug . Before drug . 20 min after drug . 50 min after drug .
0 0 0 0 75 0
Saline . DOI .
Before drug . 20 min after drug . 50 min after drug . Before drug . 20 min after drug . 50 min after drug .
0 0 0 0 75 0

Androgen-treated lizards (OVX plus T) were injected ip either with 0.9% saline or 1 mg/kg DOI (n = 8 per group), and receptivity was noted before (before drug), 20 min after injection (20 min after drug), or 50 min after injection (50 min after drug). Previously nonreceptive OVX plus T lizards demonstrated receptivity 20 min after DOI injection and returned to a nonreceptive state 50 min after injection (P < 0.001). X 2 = 12.713 P < 0.001.

Stimulation of 5-HT2A receptors by DOI stimulates receptive behavior, in OVX, androgen-treated (OVX plus T) C. uniparens: DOI, dependent variable, percentage (%) of receptive animals

Saline . DOI .
Before drug . 20 min after drug . 50 min after drug . Before drug . 20 min after drug . 50 min after drug .
0 0 0 0 75 0
Saline . DOI .
Before drug . 20 min after drug . 50 min after drug . Before drug . 20 min after drug . 50 min after drug .
0 0 0 0 75 0

Androgen-treated lizards (OVX plus T) were injected ip either with 0.9% saline or 1 mg/kg DOI (n = 8 per group), and receptivity was noted before (before drug), 20 min after injection (20 min after drug), or 50 min after injection (50 min after drug). Previously nonreceptive OVX plus T lizards demonstrated receptivity 20 min after DOI injection and returned to a nonreceptive state 50 min after injection (P < 0.001). X 2 = 12.713 P < 0.001.


Sex steroid hormones during the ovarian cycle of an all-female, parthenogenetic lizard and their correlation with pseudosexual behavior

Cnemidophorus uniparens is a unisexual lizard that reproduces by parthenogenesis. Individuals of this species display male-like and female-like copulatory behaviors during different phases of the ovarian cycle suggesting that these pseudocopulatory behaviors are hormonally activated. To learn more about both the endocrinology of parthenogenesis and the possible hormonal activation of male-like copulatory behavior in female individuals, we (1) characterized changes in plasma levels of the sex steroid hormones progesterone, 5α-dihydrotestosterone, testosterone, and 17β-estradiol during the ovarian cycle in both free-living and captive individuals, and (2) measured sex steroid hormones in plasma collected from captive individuals immediately after they expressed male-like or female-like copulatory behavior. In general, the pattern of secretion of ovarian hormones in C. uniparens appears to be similar to that of other oviparous vertebrates with similar reproductive cycles. Estradiol is elevated only during the preovulatory phase, whereas progesterone increases slightly during vitellogenesis and then increases dramatically following ovulation. Circulating levels of androgen are very low and are generally below the sensitivity of our radioimmunoassay at all stages of the ovarian cycle. The hormonal correlates of female-like copulatory behavior suggest that, as in other vertebrates, female receptivity is activated by a synergism of estradiol and progesterone. There is no evidence that the hormonal cycle has been altered to produce elevated levels of androgens during the phase of the cycle when male-like behavior is expressed. Rather it seems more likely that the central nervous system has evolved a novel response to a typical pattern of ovarian steroid hormone secretion. At present, the best hormonal correlate of male-like behavior is that changes in plasma levels of progesterone closely parallel changes in probability of expressing male-like behavior.


Reproductive Strategies in Plants: Shaping Genes, Genomes, Populations and Species?

Plants have evolved an incredible diversity of strategies to optimize their sexual reproduction. The physical distance between plant male and female organs varies from hermaphroditism to biparental reproduction. The investment of resources in different sexes is also extremely diverse. For example, male gamete .

Plants have evolved an incredible diversity of strategies to optimize their sexual reproduction. The physical distance between plant male and female organs varies from hermaphroditism to biparental reproduction. The investment of resources in different sexes is also extremely diverse. For example, male gamete dispersal can be wholly aspecific, relying on the mass production of pollen to saturate the environment and maximize the chances to encounter the maximum of receptive females through wind dispersal. On the contrary, it can be explicitly mediated by a single pollinator or targeted to a single female receiver via pollen dispersal units such as pollinia. Plants have also evolved pseudo-sexual strategies such as apomixis or self-fertilization to ensure reproductive success when pollen vectors or compatible mates are scarce. The type of reproductive strategies employed are, nevertheless, believed to have profound consequences on the evolution of populations by influencing the nature and strength of the selective forces driving genome and phenotypic evolution (e.g., sexual selection or sexual conflict) while at the same time, also, conditioning the population genetic parameters that determine the efficacy of natural selection. As a result, these strategies also impact macroevolutionary processes, including the rates of speciation and extinction.

Our understanding of the mechanisms driving the evolution of reproductive strategies and of the extent to which they might influence evolutionary processes is, however, still limited. In particular, while these questions have, so far, mostly been addressed through theoretical modeling, empirical evidence remains scarce. Nevertheless, with the latest progress in genetics, genomics, and molecular biology, it is now possible to identify the evolutionary scenarios that have led to the selection of the contributing genetic variants and determine whether ‘natural experiments’ support theoretical frameworks. Thus, this Research Topic aims at gathering experts in molecular biology, genomics, theoretical evolutionary biology, population genetics or developmental biology to provide a holistic vision of the causes and consequences of reproductive strategies in plants.

Original Research, Opinions, Perspectives, Hypothesis, Reviews and Mini-Reviews related to the following topics in model and non-model organisms are welcome for submission:
• Genetic basis of reproductive strategies
• Hybridization barriers related to reproductive modes, sexual selection or sexual conflict
• Population-level studies on reproductive strategies in natural environments
• Theoretical modelling of the relationship between population fates and reproductive strategies
• Molecular mechanisms underlying shifts in reproductive strategies
• Genomic consequences of shifts in reproductive strategies

Keywords: Plant reproduction, integrative biology, mating systems, sexual selection, plant evolution

Important Note: All contributions to this Research Topic must be within the scope of the section and journal to which they are submitted, as defined in their mission statements. Frontiers reserves the right to guide an out-of-scope manuscript to a more suitable section or journal at any stage of peer review.


Fungal Symbionts as Manipulators of Plant Reproductive Biology

Symbioses have shaped the evolution of life, most notably through the fixation of heritable symbionts into organelles. The inheritance of symbionts promotes mutualism and fixation by coupling partner fitness. However, conflicts arise if symbionts are transmitted through only one sex and can shift host resources toward the sex through which they propagate. Such reproductive manipulators have been documented in animals with separate sexes but not in other phyla or sexual systems. Here we investigated whether the investment in male relative to female reproduction differed between hermaphroditic host plants with versus without a maternally inherited fungal symbiont. Plants with the fungus produced more seeds and less pollen than plants lacking the fungus, resulting in an ∼40% shift in functional gender and a switch from male-biased to female-biased sex allocation. Given the ubiquity of endophytes in plants, reproductive manipulators of hermaphrodites may be widespread in nature.


Acceso fácil a las palabras y expresiones más populares del diccionario Inglés Definiciones Reverso

Development of the Arabidopsis The production of females from unfertilized eggswithout meiosis. Este sitio contiene funciones que requieren JavaScript.

Types of ovules present within the Credo Referencehttps: Click here to log in through your library Having authentication issues? Reproduction in flowering plants without the fusion of gametes.

Apomixis – Referencia Credo

Pattern of seed development to show Full text Article apomixis Collins Dictionary of Biology. A carpel right with insert showing It is therefore difficult to detect when a plant is reproducing agamospermically without studying it under controlled conditions.

The Arabidopsis triploid central The mechanism of agamospermy varies, but three types can be recognized: Agamospermy is a degenerate form of sexual reproduction and the fruits and seeds that are produced have a deginicion normal appearance and are dispersed in the normal way.

Stained sections of developing seeds Another indication of agamospermy is that the offspring are all identical to the seed parent and do not vary from one another as sexually produced offspring do.

Apomixxis and apomictic reproduction in Apomixis is especially common in the grass, rose, and aster families. Because the plant embryos grow from egg cells without being fertilized by pollen, the seeds that are formed are clones of each other and of the mother plant.

Genetically modified plants that reproduce using apomixis are therefore much less likely to lead to accidental gene transfer to wild populations than those that reproduce sexually. The term covers all types of asexual reproduction, including vegetative reproduction in which a plant is propagated by organs other than the sex organs in the flower, and agamospermy, in which seeds are produced without fertilization.

This method of pseudosexual reproduction is regularly used in The phenomenon of embryogenesis without the formation of gametes, or fertilization, i.

Annual parallax – atomizer: Diccionario en línea Ingles-Definiciones

Explore sus otros recursos y bases de datos de la biblioteca. The phenotypes of several of the The formation and development of an embryo without the fusion of male and female sex cells.

Click here to email Credo support.

Use this URL to link directly to this page https: The offspring thus produced are genetically identical to their mother This can occur in both plants and animals but is If pollination is prevented and yet viable seeds are aopmixis produced, agamospermy must be operating. In certain diploid organisms: Search Buscar en Credo. Most common in botanical contexts. Stages of development of the embryo Full text Article apomixis microbiol.

Habilite JavaScript para la funcionalidad completa del sitio. A further complication is that some plants must be pollinated before apomictic seed formation can occur the pollen stimulates seed development but does not actually fertilize the egg cell. Apomixis The Encyclopedia of Seeds:


Watch the video: Parthenogenesis: Virgin Births (May 2022).